h2g2 The Hitchhiker's Guide to the Galaxy: Earth Edition

(Oh, I like that one!)


because all sane people have a survey done

http://www.portlandgallery.com/index.phtml?page=single&id=425

For a guide entry I'm working on.

http://www.trillian.cc/

From adding it as a handy link in my last post

To my child
Just for this morning, I am going to smile when I see your face and laugh when I feel like crying.
Just for this morning, I will let you choose whatever you want to wear, and smile and say how perfect it is.
Just for this morning, I am going to step over the laundry, and
pick you up and take you to the park to play.
Just for this morning, I will leave the dishes in the sink, and let me teach you how to put that puzzle of yours together.
Just for this afternoon, I will unplug the telephone and keep the computer off, and sit with you in the backyard and blow bubbles.
Just for this afternoon, I will not yell once, not even a tiny grumble when you scream and whine after the icecream truck, and I will buy you one if he comes by.
Just for this afternoon, I won't worry about what you are going to be when you grow up, or second guess every decision I have made where you are concerned.
Just for this afternoon, I will let you help me bake cookies, and I won't stand over you trying to fix them.
Just for this afternoon, I will take us to McDonalds and buy us both a Happy Meal so you can have both toys.
Just for this evening, I will hold you in my arms and tell you a story about how you were born and how much I love you.
Just for this evening, I will let you splash in the tub and not get angry.
Just for this evening, I will let you stay up late while we sit on the porch and count the stars.
Just for this evening, I will snuggle beside you for hours, and miss my favourite TV shows.
Just for this evening, when I run my fingers through your hair as you pray, I will simply be grateful that God has given me the greatest gift ever given.
I will think about the mothers and fathers who are searching for their missing children, the mothers and fathers who are in hospital rooms watching their children suffer, and screaming inside that they can't handle it anymore.
And when I kiss you goodnight I will hold you a little tighter, a little longer. It is then, that I will thank God for you, and ask him for nothing, except one more day


It was, honest!!

>LockSt_1-A05-DO-PATH.F.ab1 862 72 424 ABI
CTTGTCTTCTCTTGATTATCTGATATTCTGATGGATGTTATTCTTATTTG
TTGATCAGTGCTTTGCCAGCCTACCAACAGACACATTGTTAGAATAAGCA
AATTCACAAGGAAGCCACTGCAAAGGAAATGCATGGCCAGTCACAAACCC
TCAGCTCATCTCGGCGAACGAAGTGCTGCTGGTCTCCTCTTATCCTGTGA
AAACATAGTCAGGGGTGTGAATATATACTACCATGACTGGGGAAGAATTG
CTTCATCCAGCAAGTTTCAAAGAACTGAATGTGCTGGAAACAAATTTAGC
GCTAGGACTAGGATAGGATGGAACATCACGCACGTATCCAAGATGAGACG
CTCGTATGCTTCTGGGATTTTGACGCCATTGTACCGCATCCCATACGATA
GATCCAGTTCGCTTTGTTCGGTTGCCATTTCCAGTCCGGCTTTTTTGACC
TGCAAAAGTTCGTTCTTTAGACATACAATTCTGCCGCATCTTTTTTTCTC
TCCTTTAAACAAAGCGGGAAATTCAAAGGCTAGAGCTTACAGAGGTAAAT
GTATGTACCGCTAGTTTCATGCACATGCCTTCTGATGGCTGCAGGCGAAT
GACAAACTCATTCCTGCCCTTGGTTCTTGCCCATAAAAGAGAGCACAGAG
GATTAAACACGTTCAGTGCAACCAGACCAGTTTAAATGGAAATCTGCTGC
TTTGAACAGAATCTTTGAAGGCAATAATCCCCAGTGCAATCCCGTTTTCC
GGGGGAAATGGGGAAATAACCGTTCAAATCAGCGGTGCACTTAAAGGATA
CTACAATATTCTTTAATACTTGAAAAACCCGAGGAACCACATCTAAACAG
GACCCCGGACTA

Is that DNA or something?

Uh-huh, some stuff I got back from sequencing.

Ste

Abi's DNA, by the look of the top line

Am I the only one who looked all the way through it to see if I could find AGG/GAG? I highly suspect that I am

ABI make like 99% of the sequencers in the world. Advanced Biosystems Something. It's actually a bit of corn DNA.

Ste

Er, I see. I think

sland. Who thought of that name?

Arkansas and New Hampshire - I don't know anything about these states, but I get the distinct impression that I'm not missing much.

No, this is not the next-generation Trillian we've been working on!

(I copied that from the "Trillian" link pasted above. To console myself! My buffer was empty up until that point, but I just had to say something. This is the most brilliant idea for a thread I've ever seen. Can we have a "five favourite conversations" on the front page, when you've run out of "Five Favourite Entries"?)

Sorry I am, but Star Wars quotes I cannot do. Monty Python quotes always on hand they are

Here are the last 3 of my 50+ clips;
http://www.yankee-clipper.net/
A super powerful Windows clipboard extender/memory- now in its third generation. Handles Pictures, Richtext, URLS, etc - any size. Features printing, drag and drop, optional permanent storage of clippings. Familiar "Outlook" interface. Freeware!
Saves past 200 text and RTF, 20 BMP and Metafile, and 200 URL clipboard entries.
Has the ability to save and re-use "boilerplate" clippings. Simply right-click on the item and select "Send to boilerplate". Unlimited boilerplate collections can be created.
URL aware- links copied to clipboard can be instantly launched
Has a "Load and Shoot" function to paste text anywhere
Can float on top of other applications for fast pasting
No size limits for "clippings"
Prints any text clipboard entry, nicely word-wrapped
This is a simple program to understand and use
Has a global hotkey to make the application visible when hidden, and another to instantly show and select past "clippings" without showing the application.
Clippings can be dragged & dropped to/from YCIII.
Can strip unwanted "quote" characters ("<", "|") from "clippings".
Support for Internationalization. Install include Italian, French, and German are in the install. More to come ... Just rename Internation.ini.[Language] to International.ini (Looking for people to translate to other languages, please)
Supports ordering of boilerplate items
By popular request (They dragged me kicking and screaming...): the ability to "chirp" when a new clipping is detected. Just rename "clip.wav.Bak" to "clip.wav" or copy in the file of your choice and name it "clip.wav".
You can now instruct YCIII to ignore pictures (METAFILES) from problematic apps such as MS Excel which copies metafiles of nearly infinite width to the clipboard when you select an entire row. This metafile isn't of much use at a later time anyway.
Free- totally, no strings attached.
One of my "boilerplates" contains all the GML tags


Alji

F88210?thread=187023

It seems I can't advertize freeware!

Alji

Barclodiad y Gawres

Andy

h2g2 Support