A Conversation for Whose Line is it Anyway - A (not so) temporary Home

Topic Drift

Post 201

2legs - Hey, babe, take a walk on the wild side...

smiley - wow I was trying to figue out how you did that smiley - laugh where didga get the program from?
...
...
Meanwhile, a small inferiour dark corner of the underlaying foundations underpinning the ordatious carpet soaked fauna of the street lighting.
As if by industrial strength cleaner solution, the birds swam sweely in the sky, and another of those darn nantlepieces flowed gently away into the swaying rays of light begining to fray the edges of the dark sky as night fell.
Swiftly examining the situeation the cucumber sandwich, free at last from its dungeon like tortourous expeiances as the hands of the undead host lunged, knocking me from the side of the house, and the sky missed.
unfortunatly the mist didn't and the tortrous mindswaying of the night dawned onto an unexpecting small villaged nestled beneath the arch of a lowly empty sandwich wrapper.
and finally it dawned, but alas to late, last orders settled and the wine of the soul skittles embarassingly away to flight a fancy of unrelished prudance.


Topic Drift

Post 202

Argon0 (50 and feeling it - back for a bit)

Pru Danced divinely with the Cow that had jumped over the moon, at its welcome back to Earth Party. The Cat lead the band on its Fiddle, while the little dog laughed, it was insane you see - the Fork running away with the spoon had been the last straw that broke the Camels back....


Topic Drift

Post 203

2legs - Hey, babe, take a walk on the wild side...

a quick look at the table; remind her not, the beautiful, wayward, laughing boy, with his naughtiness, his enormously large enigma, but she considered not hair but fair. its ceaseless hurrying onward sweep, its tons of water rushing
on for all time, as long as the face of the earth should remain
unchanged
and wet. This was not the third time.
But as she would not make refernece to the future so the future would not refereence her, the vanishing peanut containers were admitidly a source of pertibation, but for what was the function of the small pieces of paper that he shuffled so frantically?


Topic Drift

Post 204

Argon0 (50 and feeling it - back for a bit)

::UNicycling, Juggling Purple Weasels enter stage left::


Topic Drift

Post 205

2legs - Hey, babe, take a walk on the wild side...


Do you bite the thumb of a passing carrot, or are your entanglements of a deleterious nature?

Five ounchs for presently.

Fo what dost this manner of mind sing?

Thrice the brinded cat hath mewed

jest you not of the table that flies aloft be rapture of the flesh to the body of the spirit

tis not what you say that makes your bed such danger is the banana of the table

(moris dancers enter stage above)


Topic Drift

Post 206

Encapsulated Life Pod Number 3- Muse of Gibberish

Morris dancing originally began in Saxon times as a form of mating dance. The craze swept across villages throughout England, and soon becamse established as the national past-time. During the 100 years war, Morris dancers were sent into battle with bags of rocks. That is why, to this day, morris dancers wear little bags around their waists. The bags are not, as is sometimes assumed, useful places for the Morris dancers to keep contact lense solutions in. The bells and stick were introduced in 1895, by Batten MtBurg, the fifth Earl of Ongar, just, as he put it, "for a laugh". Today, however, the climate has turned against the Morris dancers, who can now mainly be found hanging around railway stations badgering passengers for small rolls and bits of cheese.


Topic Drift

Post 207

2legs - Hey, babe, take a walk on the wild side...

is this amazing or what: 1 gctgtctgcttgtgtgtgtgtgtctgggagtgagaacttcccagtctatctaaggaatgg agggagggacagagggctcaaagggagcaagagctgtggggagaacaaaaggataagggctcagagagcttcagggatatgtgatggactcaccaggtgaggccgccagactgctgcaggggaagcaaaggagaagctgagaagatgaaggaaaagtcagggtctggaggggcgggggtcagggagctcctgggagatatggccacatgtagcggctctgaggaatgggttacaggagacctctggggagatgtgaccacagcaatgggtaggagaatgtccagggctatggaagtcgagtatggggacccccacttaatgaagacagggccatgtagagggccccagggagtgaaagagcctccaggacctccaggtatggaatacaggggacgtttaagaagatatggccacacactggggccctgagaagtgagagcttcatgaaaaaaatcagggaccccagagttccttggaagccaagactgaaccaagcattatgagtctccgggtcagaatgaaagaagagggcctgccccagtggggtctgtgaattcccgggggtgatttcactccccggggctgtcccaggcttgtccctgctacccgcacccagcctttcctgaggcctcaagcctgccaccaagcccccagctccttctccccgcagggcccaaacacaggcctcaggactcaacacagcttttccctccaaccccgttttctctccctcaacggactcagctttctgaagcccctcccagttctagttctatctttttcctgcatcctgtctggaagttagaaggaaacagaccacagacctggtccccaaaagaaatggaggcaataggttttgaggggcatgaggacggggttcagcctccagggtcctacacacaaatcagtcagtggcccagaagacccccctcggaatcggagcagggaggatggggagtgtgaggggtatccttgatgcttgtgtgtccc c
//
(prize for guessing what it is: NB; it aint random letter arrangement even if it appear so to unacostomed)


Topic Drift

Post 208

good plan (not a member of the denial club at A638589)

badgers are not often found on railway stations, the last time i saw one there was back in 92, the year of the great badger station invasion when badgers threw themselves onto the tracks in a protest against high rail fares.


Topic Drift

Post 209

2legs - Hey, babe, take a walk on the wild side...

IF the rails are that high, it must be a long way down when you get of the train?
Two sausages two eggs two rashes of bacon, fried mushrooms toast coffee ciggerette H2g2
damm this life is stressful.


Topic Drift

Post 210

good plan (not a member of the denial club at A638589)

incorrect ratio of breakfast, should always be double the amount of bacon as eggs and half a sausage to every third hash brown, two cartons of orange juice to every cup of tea. no i made that last one up.


Topic Drift

Post 211

2legs - Hey, babe, take a walk on the wild side...

The consistant lack of hash-brown in the canteen is a constant sauce of worry.
i worry ever so much, did i ever tell you about Earnest Ipstoft? Noone n here has ever seemed to have heard of him, which i find strange, maybe he is not included for studying any more in degree courses or "A" levels.
Strange watching the hunters out in India hunting tigers; they bite scratch and make an awful fuss; there is no point stroking them and saying "here puss puss".
Dreadful table manners, like the time of the great imagination, who can forget that?
well, ust to remind you what happened was, smiley - erm never mind.
as i was saying about breakfast.
i am still constantly amaxed by the slow development of the human genome as a resource; the datamining toools are partially there but we need more; and the stability and validity of the datasets making up the sequence databases is less than promising. wouldn't you imagine that it will take a second generation of sequence data not based on the high throughput sequencing methods?
were talking about Shirts, the problem of shirts, ar they necessary. Where is shirts, i don't kno.
cautious as he hops what do you want to know about shirts.
a man is not dressed unless he is wearing a nice shirt.
how about long shirts?
earls court olympia holding the shirt event.
but that isn't the whole story. Three weeks for the shirt clean express service; but, that was more or less an idle moment in the dispersion of the dataset.
once the mice were 13 weeks old we extracted there spleens.
ah,where was i
?
Mr Kangrish was not pleased by the sight of his decapitated wife in the sitting room; he immediatly called the butler and had her removed.
He was even less amused when he recieved hte bill for having the upholistyr and carpet cleaned.
He refrained from persuing the perpitrators for want of more time to d devote to his consideration of the problems that were his real sauce of worry, his ornimental tree garden.
Hmmm, completely forgoten what i was going to say now ?
mash the graveyard smash caught on late one night an awful fright.


Topic Drift

Post 212

Granny Weatherwax - ACE - Hells Belle, Mother-in-Law from the Pit - Haunting near you on Saturday

They peel them with their metal knives! smiley - smiley


Topic Drift

Post 213

Vic

And the face mask is removed to find beautifully polished
and immaculatly clean peachy skin


Topic Drift

Post 214

good plan (not a member of the denial club at A638589)

wishfull thinking indeed, never believe what you read on the packet, especially with fish.


Topic Drift

Post 215

2legs - Hey, babe, take a walk on the wild side...

Its not even butter, not even close.


Topic Drift

Post 216

good plan (not a member of the denial club at A638589)

really? i can't believe it.


Topic Drift

Post 217

2legs - Hey, babe, take a walk on the wild side...

its almost to good to be true but i going to hoover all night tonight in reverence to knighthoover as i night hoover nighhoovernighthoovernighthoover mad is the first phase of relolution + for the hoovering through the night of the main capital suggestion of one so talked of yet so rarely ene seen for today of all days we must raise our wrist and tip tip tip tip tip the ale for hoovering at night is no mean task and power is needed, but we have the power, us few us mental few, together we can change the world by hoovering thorugh the night nighthoover the saviour of the universe nighthoover the inexplicible nighthoover the rarely seen nighthoover the hoover of the night, so in kind we bestow our greatest gift, and emulate the deeds of one so great, and hoover we must.
but the train wasn't late, it was an illusion created by the most devious of evil plans. the slimey villen stood and pictured himself in another synaryo in which a hoover moved rythemically over the floor, and the universe was saved by the combined efforts of teh mice police; who as we all know never sleep.
the blubberhouse of the lizzard became the scapegoat for teh mistakes of past night workers and day hoovers alike we might not win the floor but we will win the battle, hoover hoover all across the land gather up your vaccume cleaners and hoover, all together now::
hoover hoover,
we must hoover hoover,
hooover hoover, hoover thorugh the night.

a rough sea of treacle flowed over her back as she lay on the silver sand. her hair trailed delicatly over the grains of a million rocks and the light caught its lenght full on.
the waters moved, and flowed and ebbed, and as the light failed she awoke, her face a immage of beauty in the half-light of teh moon, from atop the cliff a trail of dancing lights bobbed along an unseen path.
then, as the crown of leaves fell over her natural enterty the truth came of the fall, the fall of an empire, the fall of her spirit.
she caressed the sand, she kissed the rock, and the sea continued to ebbe and flow, the lights continued to move.
and all throughout the land the sounds of a thousand, maybe a hundred thousand hoovers brought sore relief and nighthoover was there; standing on the beach, hoover in hand, and the land rejoiced for he had saved them,
the sea continued to flow the beauty continued and all was well;
the sand of a million rocks soaked up the light and the hoovering continued.


Topic Drift

Post 218

Pander, Champion of Lost Causes (17+25)+7*0 = 42

My vaccum cleaner really sucks. It can clean almost anything that you want it to. I once passed out trying to outsuck a vaccum cleaner (needless to say, it won). I put my lips on the end of the hose and sucked while it was on. I got all dizzy and then fell over. When I woke up it was 11:00AM the next day. I have too much free time in the summer.


Topic Drift

Post 219

2legs - Hey, babe, take a walk on the wild side...

smiley - smileysmiley - laughsmiley - yikes Reminds me of the time I went to the shop, what an experiance that was, i don't needless to say ever want to repeat the experiance. Oh, did I ever tell of my fathers involvement with a Hoover? Probably not best to go down that route. Which reminds me, the roots from the willow tree gradually grow further under the driveway, compltely distroying the surface, which had to be replaced; due to its proximity to the house, it was decided necessary to remove the entire tree, as the roots were at risk of interfering with teh foundations. Shame, a loverly willow tree, a weeping willow i do believe they are called: its branches reached down towards the ground, creating a whole world underneath its branches.
So, the shop, what should i say, very difficult to know whwere to start, it was a wet, cold october morning, must be, ooo, about three years ago now, i left the house, without taking a coat. That was the first mistake of the day. I once made a mistake and got the day completely mixed up: i thought it was teh 17 april 1956, when it actually turned out to be the 8 of December 1668, I refused to accept this error until it was passed out by a passing bakers boy. Strange. Hmm, no, compltely forgoten what i was thinggy about..


Topic Drift

Post 220

good plan (not a member of the denial club at A638589)

weeping willows are generally said to be nice trees. Why is this forum so horisontally wide? it is disruptive but also slightly subversive. i'm not complaining. why complain? life is usually pretty brilliant if you think about it. or more precisely if you don't. i should start a denial club, think i'd get any members?


Key: Complain about this post

Write an Entry

"The Hitchhiker's Guide to the Galaxy is a wholly remarkable book. It has been compiled and recompiled many times and under many different editorships. It contains contributions from countless numbers of travellers and researchers."

Write an entry
Read more