h2g2 The Hitchhiker's Guide to the Galaxy: Earth Edition

Apparently, it isn't usually possible for a biologist to look at the complete set of genes for a creature, analyse them, and work out what it's going to look like. After all, to get from the genes to the creature, you'd basically have to simulate its growth from scratch.

However, it *is* possible to look at the genes of a common house-cat and work out what it is, for the simple reason that a cat's genes contain 'CATCATCATACATCATCATCAT' repeated many, many times. (It's true )

26199

As do the genes of humans, apes and probably most animals.
We also have GAGAGAGAGAGAGAGAGAGA repeated many times. This proves that all humans are fundamentally insane.

You have to admit, though, that if a cat's DNA containly *only 'CATCATCATCATCATCATCAT', it would be pretty impressive.

Very impressive, in fact.

It would, actually, imply that cats are a fundamental consequence of the way the universe is, pretty much.

Shame it ain't true, really.

26199

Especially as it would mean they could only used one amino acid for their proteins...
Actually, if cats could do that, they would certainly be the overlords of the universe. Which would be nice.
I wonder if there are messages from cats encoded in our own DNA. That would be interesting.

What came first, the cat or the Universe??

How about the ?

Otherwise, what would the cat eat, is what I want to know.



26199

It's a very good point. But my cat doesn't like fish.
Maybe there used to be a great race of cats that did not eat fish, and they created the fish for their cat menials, i.e. a sort of slave class. Yes, that seems plausible. It also means that my cat is one of the orignal masters of the Universe. Well, he's certainly old enough...

If Cats are the original masters of the Universe, what does that make dogs? Maybe they were inter-universal pirates who entered this universe, just when everything was going well, and chased all the cats up trees.

That's probably why the universe is in the state it's in ...

Hey! Maybe cats are pan-dimensional ... which is why they chase mice ...

Have you ever witnessed a game of cat chess?

26199

cat CHESS????

Yep! Read Terry Pratchett's 'The Unadulterated Cat' for a comprehensive description...

You can recognise when cats are playing cat chess quite easily, though. There'll be at least four of them, sitting outside in full view of each other, keeping *very* still. Occasionally, one of them will get up and move to a new position.

This is cat chess. Nobody, as yet, has managed to figure out the rules.

26199

Let me tell you a little secret:

Their rules are constantly changing, it's the result of their
constantly changing DNA>>.

(Going for the pedantic record here...)

A gene that reads ...CATCATCATCAT... could encode a series of amino acids ..CAT.. or ..ATC.. or ..TCA..