h2g2 The Hitchhiker's Guide to the Galaxy: Earth Edition

As far as I am aware, DNA is made from amino acids (please correct me if I'm wrong, I'm not entirely sure that I've got all the facts right), and humans are made from DNA. Amino acids are not living, but humans are. I would like to know how something non-living can make someting living, but no-one I know can tell me.

You're wrong. DNA is made from nucleosides, while proteins are made from amino acids. DNA contains information for stringing amino acids together to make proteins, as explained in A266906 .

Humans are made of cells. Cells in turn are bags of general stuff. The outer layer of a cell is what is known as a 'lipid bilayer'. This is a double layer of lipids (fats, oils, waxes) with proteins and occasionally carbohydrates (sugars) stuck into it.

Within the cell, there are more bags of stuff with lipid bilayers as outer layers. These are termed 'organelles'. One of these organelles is the nucleus, a special organelle where DNA is stored.

Life is the result of a brain-meltingly complex set of chemical reactions which are sped up by special proteins called enzymes (see A3328355 ). Some examples of these reactions include:

*Breaking chemical bonds in carbohydrates and lipids to extract energy.
*Forming proteins from amino acids.
*Transporting atoms and molecules from cell to cell, and also across membranes within a cell.
*Replicating DNA.

etc.

Does this help any?

I suspect this one will run on a bit!

DNA isn't made from amino acids. There are quite a few components but the important bit is a long spine of organic bases that spell out a coding for the construction of proteins. It's the proteins that are built of amino acids assembled in the order prescribed by the coding in the DNA.


If we knew how something non-living can make something living, we would be part way to understanding the meaning of life, the universe, and everything

Qute a few = 3 components per nucleotide

A phosphate backbone.

Connected to the phosphate backbone are sugars- specifically one sugar called 2'-deoxyribose

Bases. There are four bases - thymine (T), guanine (G), adenine(A) and cytosine (C).

Each nucleotide thus consists of phosphate-sugar-base.
A DNA strand is simply a string of these nucleotides connected to one another through the phosphates.

A single strand of DNA is therefore usually written as a code according to the sequence of its bases as these are the only things that differ along the chain.

E.g. AACTTCTTTCAAGGGCCGGATCG

You've probably heard of DNA's double helix structure?

Well basically each base can bond strongly to its complementary base. So A is complementary to T and C is complementary to G. So a single DNA strand can be used to template another one running in the opposite direction.

E.g. AACTTCTTTCAAGGGCCGGATCG
E.g. TTGAAGAAAGTTCCCGGCCTAGC

DNA replication like this is the truly fundamental part of life's replication.

As mentioned earlier, the functional part of DNA is mostly to code for protein synthesis.

Three letter 'Codons' along the sequence of DNA code for specific amino acids in proteins.
There are 20 amino acids but a lot more potential codons so several codons code for the same amino acid in a lot of cases and there are some special codons which code for things like 'STOP' to the ribosome which is the organelle responsible for constructing proteins in a cell.

I'll stop now

Pegasus, another problem is the definition of "life". For example, are viruses alive?

The old schoolboy mnemonic is 'Mrs Gren':
Movement
Respiration
Sensitivity
Growth
Reproduction
Excretion
Nutrition

Not sure whether it's a valid concept beyond my GCSE in Biology, though .

Noone knows what life is. My personal definition is that life can self-replicate and metabolise. Lots of people slot evolution in there too.


To refer to the original question:

- DNA is a molecule made up of string of *nucleotides*
- Proteins are molecules made up of strings of *amino acids*

The order of the four different nucleotides in DNA (A, C, G and T) encodes the information on the order of amino acids in proteins. Different combinations of the 20 possible amino acids give different proteins that do different jobs - like digest food, make hair, and lots of other processes and functions in our bodies.



Ste

Traveller in Time on his head
"And the other statement is also removed:

'No one I know can tell me'

At least some tried "

According to our very own DNA, U42, life is "a matter of opinion".

http://www.biota.org/people/douglasadams/

TRiG.

Pegasus: "I would like to know how something non-living can make something living." (Post 1 in this conversation.)

DNA: "If you try and take a cat apart to see how it works, the first thing you have in your hands is a non-working cat." (The lecture referenced above.)

Bill Bryson: "It is a slightly arresting notion that if you were to pick yourself apart with tweezers, one atom at a time, you would produce a mound of fine atomic dust, none of which had ever been alive but all of which had once been you." (Introduction, A Short History of Nearly Everything.)

Thank you everyone.
It's nice to have an answer to a question that has been annoying me for a while, and it's also nice to have my misconceptions corrected.

'Life is negative entropy'

Traveller in Time stretching
"So a computer is dead but the programs are living "