Life | The Universe | Everything | Advanced Search

	Sign in or register to join or start a new conversation.

This is the Conversation Forum for How Proteins are Made << Adenosine? Subject: How to tell a creature from its genes... Posted Mar 6, 2000 by 26199   Posting 1 Apparently, it isn't usually possible for a biologist to look at the complete set of genes for a creature, analyse them, and work out what it's going to look like. After all, to get from the genes to the creature, you'd basically have to simulate its growth from scratch. However, it *is* possible to look at the genes of a common house-cat and work out what it is, for the simple reason that a cat's genes contain 'CATCATCATACATCATCATCAT' repeated many, many times. (It's true ) 26199 Read the First Reply to this Posting Subject: How to tell a creature from its genes... Posted Mar 30, 2000 by Patriarch This is a reply to this Posting   Posting 2 As do the genes of humans, apes and probably most animals. We also have GAGAGAGAGAGAGAGAGAGA repeated many times. This proves that all humans are fundamentally insane. Read the First Reply to this Posting Subject: How to tell a creature from its genes... Posted Mar 31, 2000 by 26199 This is a reply to this Posting   Posting 3 You have to admit, though, that if a cat's DNA containly *only 'CATCATCATCATCATCATCAT', it would be pretty impressive. Very impressive, in fact. It would, actually, imply that cats are a fundamental consequence of the way the universe is, pretty much. Shame it ain't true, really. 26199 Read the First Reply to this Posting Subject: How to tell a creature from its genes... Posted Apr 5, 2000 by Patriarch This is a reply to this Posting   Posting 4 Especially as it would mean they could only used one amino acid for their proteins... Actually, if cats could do that, they would certainly be the overlords of the universe. Which would be nice. I wonder if there are messages from cats encoded in our own DNA. That would be interesting. What came first, the cat or the Universe?? Read the First Reply to this Posting Subject: How to tell a creature from its genes... Posted Apr 5, 2000 by 26199 This is a reply to this Posting   Posting 5 How about the ? Otherwise, what would the cat eat, is what I want to know. 26199 Read the First Reply to this Posting Subject: How to tell a creature from its genes... Posted Apr 6, 2000 by Patriarch This is a reply to this Posting   Posting 6 It's a very good point. But my cat doesn't like fish. Maybe there used to be a great race of cats that did not eat fish, and they created the fish for their cat menials, i.e. a sort of slave class. Yes, that seems plausible. It also means that my cat is one of the orignal masters of the Universe. Well, he's certainly old enough... Read the First Reply to this Posting Subject: How to tell a creature from its genes... Posted Jun 5, 2000 by Gaurav This is a reply to this Posting   Posting 7 If Cats are the original masters of the Universe, what does that make dogs? Maybe they were inter-universal pirates who entered this universe, just when everything was going well, and chased all the cats up trees. That's probably why the universe is in the state it's in ... Hey! Maybe cats are pan-dimensional ... which is why they chase mice ... Read the First Reply to this Posting Subject: How to tell a creature from its genes... Posted Jun 5, 2000 by 26199 This is a reply to this Posting   Posting 8 Have you ever witnessed a game of cat chess? 26199 Read the First Reply to this Posting Subject: How to tell a creature from its genes... Posted Jun 6, 2000 by Gaurav This is a reply to this Posting   Posting 9 cat CHESS???? Read the First Reply to this Posting Subject: How to tell a creature from its genes... Posted Jun 6, 2000 by 26199 This is a reply to this Posting   Posting 10 Yep! Read Terry Pratchett's 'The Unadulterated Cat' for a comprehensive description... You can recognise when cats are playing cat chess quite easily, though. There'll be at least four of them, sitting outside in full view of each other, keeping *very* still. Occasionally, one of them will get up and move to a new position. This is cat chess. Nobody, as yet, has managed to figure out the rules. 26199 Read the First Reply to this Posting Subject: How to tell a creature from its genes... Posted Sep 13, 2000 by King Fabels (a.k.a. FABIUS, the confusatron) This is a reply to this Posting   Posting 11 Let me tell you a little secret: Their rules are constantly changing, it's the result of their constantly changing DNA>>. Subject: How to tell a creature from its genes... Posted Sep 8, 2003 by EwenMc This is a reply to this Posting   Posting 12 (Going for the pedantic record here...) A gene that reads ...CATCATCATCAT... could encode a series of amino acids ..CAT.. or ..ATC.. or ..TCA.. Conversation list Conversation list

Please note that Not Panicking Ltd is not responsible for the content of any external sites listed. The content on h2g2 is created by h2g2's Researchers, who are members of the public. Unlike Edited Guide Entries, the content on this page has not necessarily been checked by a h2g2 editor. In the event that you consider anything on this page to be in breach of the site's House Rules, please click here .

About | Help | Terms of Use